EST details — SGN-E628700

Search information 
Request: 628700Match: SGN-E628700
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C415866Clone name: cccp14p24
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C415866 [cccp14p24] Trace: SGN-T446473 EST: SGN-E639685 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E628700Length: 440 bp (643 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E628700 [] (trimmed) GAAGCCCCCTAAGGTCTCCTTCAAAACCAAGGTTTTCCACCCAAACATAAACAGCAATGGTAGCATTTGTCTTGATATCCTCAAAGAGCAGTGGA
GTCCTGCACTTACTATATCTAAGGTACTGCTGTCTATTTGCTCCTTGCTGACTGATCCAAATCCAGATGATCCTCTCGTACCTGAGATCGCTCAC
ATGTACAAGACTGATAGAGCGAAATATGAGACCACTGCTCGGTCCTGGACCCAGAAATATGCCATGGGTTGAATGCATATTGAGGATGCAACATT
TTATGCTAGTAGTAAATAAATAGGAAAAGAAAAAAAATCCCCAGAACTTTTGGGCTTTCTGTTTGTTTGTTCTCAAGGGATTTGAAGTATTGTCT
TGATTTGAACGTGTTTCTTCTATTATAGAGGTTTTATCGAATGTCAGAATATATTTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E628700] SGN-U617131 Coffea canephora Build 3 25 ESTs assembled
[SGN-E628700] SGN-U637348 Coffee species Build 1 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T439729 [Download] [View] Facility Assigned ID: cccp14p24.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15