EST details — SGN-E629188
Search information |
Request: 629188 | Match: SGN-E629188 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C439005 | Clone name: cccs30w2p19 |
| ||
Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E629188 | Length: 282 bp (593 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E629188 [] (trimmed)
GCTCTCTCTAAATCAGCGCACAGTAGATTTAGCCCAATTTTTTCCCACCCTCTAAATTCGCCTTCCTTTGATTCTCTCTTCTCTTGTCGTCCATC
GATCCGACTGGTGAGGTTTATTTTTGTAGGGATCGGAGGTGGATTAGGGAAATTGGGGGTGATTAATTGAGGAATTTTGAGGTGAATTATAATTA
CAAGGATTCGAAGATGTGTTTGTTGGATTGGTTCTACGGAATATTGGCCTCGCTAGGACTGTGGCGAAAGGAGGCTAAGATCTTGGTTCTGG
GATCCGACTGGTGAGGTTTATTTTTGTAGGGATCGGAGGTGGATTAGGGAAATTGGGGGTGATTAATTGAGGAATTTTGAGGTGAATTATAATTA
CAAGGATTCGAAGATGTGTTTGTTGGATTGGTTCTACGGAATATTGGCCTCGCTAGGACTGTGGCGAAAGGAGGCTAAGATCTTGGTTCTGG
Unigenes |
Current Unigene builds | |||||
[SGN-E629188] | SGN-U617771 | Coffea canephora | Build 3 | 18 ESTs assembled | |
[SGN-E629188] | SGN-U632786 | Coffee species | Build 1 | 38 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T462868 [Download] [View] | Facility Assigned ID: cccs30w2p19.i |
Submitter: None | Sequencing Facility: Cornell |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |