EST details — SGN-E629257

Search information 
Request: 629257Match: SGN-E629257
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C416202Clone name: cccp17i23
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E629257Length: 291 bp (574 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E629257 [] (trimmed) GCAAGCGCGAGGGTAGGGTCAGCATATCCCACTTAGGTAGCAAGTCCAACCAGGTCATAGATTTGGAACCAAAATCCCAGTTTGTGGATGACATC
AGCAGTGTAGAGGAGATAGCTGGTGCTTGATACTTCCATGCCCTCTGTAGATGTGAGGAAATAGGTTAAATTTCTTCACTTTGGGGATAGCTCTC
TAATCTAGAGTCCCTTTTTCCCCTAATTCTCTTGGTTGATGTGCCCTATACGGCAAAAACAAAAGGAGAATTGGGAAAACTGGACACCCTTTTTT
TTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E629257] SGN-U616428 Coffea canephora Build 3 7 ESTs assembled
[SGN-E629257] SGN-U636972 Coffee species Build 1 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T440065 [Download] [View] Facility Assigned ID: cccp17i23.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15