EST details — SGN-E629651

Search information 
Request: 629651Match: SGN-E629651
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C439131Clone name: cccs30w5o1
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E629651Length: 469 bp (575 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E629651 [] (trimmed) GATCATCATTGCACCACTTTGTTGGTGAAGAGCCTCTAAAAGAGACAGTAATAGAAGACGAACCTGTCATCGGAACAAAACAAGTTAGTGAAAAC
AGTAATGAAGAGAATGAGGATGACTATGACGTCTTGCGAAAAGCTGTGATGGAGTACTGGACTACCATGAAAGAGTATTATAAAGCTGCTGCTGA
TGCATTTGCCATAAATGATCATGAAAAAGCTCATAAGCTTATGGACGAGGGTCATTTCTTTATGAAGAAGGCACGAGAAGCTGATGAAAAATCTG
CTGAAAAGCTCATTGAAAGCAATGATGAGGAAGAAATGTTCGTCGATCTGAATGAATTTGAGCCAAAAGATGCTTTGCGCTTTCTGAAAATTCAG
TTGACTTCTCTTTCTGGCATCGCATCTTATAAATATCTCAAGGTACTTGTGGGGAGCAATGAGCAAAACGCCAAGAGTGGGCCTCGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E629651] SGN-U617046 Coffea canephora Build 3 2 ESTs assembled
[SGN-E629651] SGN-U638290 Coffee species Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T462994 [Download] [View] Facility Assigned ID: cccs30w5o1.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15