Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E630186

Search information 
Request: 630186Match: SGN-E630186
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C416773Clone name: cccp14d9
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C416773 [cccp14d9] Trace: SGN-T445085 EST: SGN-E637457 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E630186Length: 327 bp (632 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E630186 [] (trimmed) GAAATGGTGAAGCTTTCTTGCCGAAATGGCAGCTTGAAATTTTGTGGTGGTTTTTATGAGTTATTCTGTTTTTCTTAATTAAGCAATTCAATTGA
CAATTTTTTAGTAGGTGCATCCCATATCTGGTGCCTGTATGTTTCGGTTTCTATGTATGTCCCATTTTTTCCCCAGATTATAATTCTACAATAGA
GAGTTTTGGGGGTTTTGCTGGGTTCCCCATCTTAGGTCCTTGATTTTGCAGAAACTGGGAGATTTGTATCTTCAATCTGCGATAGAGCTCAGTGT
ATCTTCAATTAATTATCGAATCATCTTAGATGTTTGGGAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E630186] SGN-U619810 Coffea canephora Build 3 6 ESTs assembled
[SGN-E630186] SGN-U635084 Coffee species Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T440636 [Download] [View] Facility Assigned ID: cccp14d9.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15