EST details — SGN-E632413
| Search information |
| Request: 632413 | Match: SGN-E632413 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C438732 | Clone name: cccs30w7l20 |
| ||
| Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C438732 [cccs30w7l20] | Trace: SGN-T462595 | EST: SGN-E628114 | Direction: 5' | Facility: Cornell |
| Sequence |
| Sequence Id: SGN-E632413 | Length: 135 bp (221 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E632413 [] (trimmed)
GCTTGGATCTGCAATCCACCAGGAGAATTTCCACCAAGAATAAAGAGACTATGTTGTCGAAATCGCTGCGTGGATGTCACTTCTGATGTTGAGAA
CTGTGGATTCTGTGGAATCAGATGCCCATTTACTTGGCAA
CTGTGGATTCTGTGGAATCAGATGCCCATTTACTTGGCAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E632413] | SGN-U616759 | Coffea canephora | Build 3 | 11 ESTs assembled | |
| [SGN-E632413] | SGN-U636246 | Coffee species | Build 1 | 11 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T463685 [Download] [View] | Facility Assigned ID: cccs30w7l20.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
