Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E633166

Search information 
Request: 633166Match: SGN-E633166
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C418582Clone name: cccp14n5
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C418582 [cccp14n5] Trace: SGN-T446969 EST: SGN-E640511 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E633166Length: 494 bp (606 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E633166 [] (trimmed) GGATAGATAGATATGGCCAGATCGAGCTCGCAAACTCTCAGAGTAGTCTTTTGCAGTCTACTCATCCTCGGACTAACAGCCGTTGCCCAGGCTAA
AAAATCAGACAATGACTTGAAAGAAGTGACTCACAAAGTTTACTTCGATGTCGAGATTGATGGAAGACCTGCTGGGCGGGTGGTGATGGGTCTCT
TTGGCAAAGCAGTTCCTAAGACAGCAGAAAATTTCAGAGCATTGTGCACAGGGGAGAAAGGTACTGGAAAGAGCGGGAAGCCTCTCCATTACAAA
GGAAGCAAATTCCATAGAATCATCCCCAACTTCATGATTCAAGGTGGTGACTTCACCCTTGGTGATGGTAGGGGTGGGGAGTCAATTTATGGAGA
GAAATTTGCTGATGAAAATTTCAAAATTAAGCATACCGGACCAGGCCTGTTGTCAATGGCTAATGCTGGTGCTGACACCAATGGTTCACAGTTCT
TCATAACAACTGTCACAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E633166] SGN-U613643 Coffea canephora Build 3 14 ESTs assembled
[SGN-E633166] SGN-U634325 Coffee species Build 1 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T442445 [Download] [View] Facility Assigned ID: cccp14n5.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15