EST details — SGN-E634303
| Search information |
| Request: 634303 | Match: SGN-E634303 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C425117 | Clone name: cccs18w9l17 |
| ||
| Library Name: cccs18w | Organism: Coffea canephora |
Tissue: Edorsperm and perisperm
Development Stage: 18 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E634303 | Length: 103 bp (588 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E634303 [] (trimmed)
GATTCTTGAATAGACTACATATGATACTAACTTCGTGTATATATTAAGTTTATAGCATGACTCAAAACATCATGTGACCAGGAAATCTCGTCATC
TTATGTAC
TTATGTAC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E634303] | SGN-U614992 | Coffea canephora | Build 3 | 12 ESTs assembled | |
| [SGN-E634303] | SGN-U632680 | Coffee species | Build 1 | 17 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T448980 [Download] [View] | Facility Assigned ID: cccs18w9l17.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
