EST details — SGN-E636071
| Search information |
| Request: 636071 | Match: SGN-E636071 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C439652 | Clone name: cccs30w7f24 |
| ||
| Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C439652 [cccs30w7f24] | Trace: SGN-T463515 | EST: SGN-E631712 | Direction: 5' | Facility: Cornell |
| Sequence |
| Sequence Id: SGN-E636071 | Length: 134 bp (228 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E636071 [] (trimmed)
AAGATGGCCATTGGATTGGCGTTAAGCCCCTTCCTGATGCATTTGTGGTGAACATAGGTTTGTTACTGGAGGTCATTAGCAATGGAAAGCTAAAA
GGTGCTGTGCATCGAGCGGTTACAAATTCAGCTTGTTCC
GGTGCTGTGCATCGAGCGGTTACAAATTCAGCTTGTTCC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E636071] | SGN-U617694 | Coffea canephora | Build 3 | 11 ESTs assembled | |
| [SGN-E636071] | SGN-U634914 | Coffee species | Build 1 | 17 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T464586 [Download] [View] | Facility Assigned ID: cccs30w7f24.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
