EST details — SGN-E637076

Search information 
Request: 637076Match: SGN-E637076
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C420984Clone name: cccp6e8
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E637076Length: 470 bp (570 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E637076 [] (trimmed) GCCTCATGAAGAAAACTTTGGCTATGCATGAGGAGTCATCAGCCCGGCGCCAGGTTGAAGACGATGTCCATGAAGGAGCTGTTCCTGCTTATCTA
CTTGATCGTGAATCTACTACTAGAGCCAAGGTTCTCAGCAACACTATAAAGCAGAAGAGGAAAGAAAAAGCTGGAAAATGGGATGTACCTCTTCC
CAAGGTCCGCCCTGTGGCTGAGGATGAGATGTTCAGAGTAATCAGATCTGGGAAAAGGAAAACAAAGCAGTGGAAGAGGATGATCACTAAAGCGA
CTTTTGTGGGTCCAAGTTTTACAAGGAAGCCACCCAAATATGAGCGGTTCATCCGACCAACCGGTTTAAGGTTCACCAAGGCTCACGTGACTCAT
CCTGAACTTAAATGTACCTTCAATCTTGAAATTATTGGAGTGAAGAAAAATCCCAATGGTCCAATGTATACATCTCTTGGTGTTGTAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E637076] SGN-U618817 Coffea canephora Build 3 4 ESTs assembled
[SGN-E637076] SGN-U632744 Coffee species Build 1 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T444847 [Download] [View] Facility Assigned ID: cccp6e8.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15