Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E641398

Search information 
Request: 641398Match: SGN-E641398
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C419139Clone name: cccp14g4
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C419139 [cccp14g4] Trace: SGN-T443002 EST: SGN-E634036 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E641398Length: 501 bp (603 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E641398 [] (trimmed) GCCTTGCTTCATATGTTGAAAGATGAGAGATTGGTTCAACATCAGCCAACGCAGTACCCGACGTCTGAGGAGCTGAGTATTGGCCAAATTAAGTT
TAAGGCTTTTGACTTGGGAGGCCATCAGATCGCTCGCAGAGTCTGGAAAGATTATTATGCCAAGGTGGATGCAGTTGTTTATCTCGTGGATGCTT
ATGACAAAGAAAGGTTTGCAGAATCAAAGAAAGAGCTGGATGCTCTTCTCTCTGATGAGTCCTTGGCAAATGTCCCTTTCCTTATTCTGGGGAAC
AAGATAGACATTCCTTATGCAGCTTCTGAGGACGAGCTGCGTTACCACATGGGCCTGACAGGCATCACTACTGGAAAGGGCAAGGTAAACTTGGC
AGACTCAAATGTCCGTCCCCTTGAGGTCTTCATGTGCAGCATTGTGCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATATATAA
AGTAGTGGGCTTTAGTGGGGGGTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E641398] SGN-U617771 Coffea canephora Build 3 18 ESTs assembled
[SGN-E641398] SGN-U632786 Coffee species Build 1 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T447522 [Download] [View] Facility Assigned ID: cccp14g4.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15