EST details — SGN-E642759

Search information 
Request: 642759Match: SGN-E642759
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C442615Clone name: cccs30w12j19
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E642759Length: 224 bp (1002 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E642759 [] (trimmed) GGAGCCATTTCCACCAAAATCCCATCCACCGAACCCATGTCCACCATCCACCGGAGCCATGTCCACCAAAACCTGATCCACTAAATCCATGTCCA
CCAAAACCTCACCCTCATCATGGTACTGATCATCCTTCTAAAGCCAACTCTCCACCTCTATAACTAGGTTGATATATCTTGGTCTAGCATTTACT
TGTTTTGCTTATATTTGTTGTTCTACTATTATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E642759] SGN-U616759 Coffea canephora Build 3 11 ESTs assembled
[SGN-E642759] SGN-U636246 Coffee species Build 1 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T466478 [Download] [View] Facility Assigned ID: cccs30w12j19.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15