EST details — SGN-E646201

Search information 
Request: 646201Match: SGN-E646201
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C446057Clone name: cccs30w24b16
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C446057 [cccs30w24b16] Trace: SGN-T471127 EST: SGN-E647408 Direction: 5' Facility: Cornell
Clone: SGN-C446057 [cccs30w24b16] Trace: SGN-T470296 EST: SGN-E646577 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E646201Length: 669 bp (1005 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E646201 [] (trimmed) CCCACATGCCAGTGCCCCAGGTCCAGGCGCTGGTCCTGCTTCAGCTTCTGTAGGAGCGGAACCTGAGGCAGATGCAACAGCCCCTGTTAATGATC
CTTCTGTCACTCACCGAGCAATCAGCAGTGAATCATTGCAATGCACCCCAAATCTTACTAGTGTTCCTAGTGGTCAACTCTCTGCTTCGTCATCT
GGATCAGTTGCCATGCTTAACAACCCTCGAGATCTCTCCACTGACAATAGAAGCGTGGCTCGTCAGGCACCATCAGGTCAAGATAGAGCAGGAAC
ATCAGATTTCCAGTCTTTTTCAGATTCCTGGAGATCTCGTTTTAGTGCAATGTCAATGAAATACAAAGAATCTCTTTCAAAGAGCACAAGAGGAT
GGAAAGAAAGGCTTTTTGCACGAAGTAATTCCATGGCAGATATTCGCTCAGAAGTTAGGAGAGAAGTGAATGCTGGAATTGCTAGTGTTTCCCGC
ATGATGGAACGCCTAGAAACAAGAGAAAACAGTAGACCTGGTCCTGTTTCAACGTCAAATAATCCTCCAGTGACTGAGCAAAATAACCCTGGGAA
TTTGGATGAATCACCGTTGAGTGACATTTCGGCTCTTCCTGCAAATTCTGTCTCGCGTTAAGTGGTATACATTGTTTAAGCTGTTGCATCTTTCC
TCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E646201] SGN-U619598 Coffea canephora Build 3 14 ESTs assembled
[SGN-E646201] SGN-U635840 Coffee species Build 1 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T469920 [Download] [View] Facility Assigned ID: cccs30w24b16_1.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15