EST details — SGN-E648500

Search information 
Request: 648500Match: SGN-E648500
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C445249Clone name: cccs30w24n6
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C445249 [cccs30w24n6] Trace: SGN-T469456 EST: SGN-E645737 Direction: 5' Facility: Cornell
Clone: SGN-C445249 [cccs30w24n6] Trace: SGN-T469112 EST: SGN-E645393 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E648500Length: 521 bp (1033 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E648500 [] (trimmed) GGTCAAACCTGGCCATGAGCTGAGGATCCCAAATGAAGGGATGCCCATATCAAAAGAACCTGGTAAGAAAGGAAATTTGAGGATTAAGTTTGATA
TAAAATTCCCATCCAGGCTCAGCTCAAAACAAAAATCTGAACTGCGGAGGGTACTTGGGAGGACTGCTGATTAGTCCAAAATGAAGCACTGAAGA
ATATAGCTAACCAGTTATAGTGGAAACGCACCTGGATGTAAATACATCGTGACTTTGCTTGGACTAGTAGGAAACACTGTGCATAATAGGAGTAT
AGTTTAATTCGGTCGCGTGCAATATATTTGAGTTGTGTCTGGCCCCAAGTGTAGCATATTGAGCTGGTGTTCTAGTGATCGATGTTAATTTTGGT
GTTCAATGTTCAAATCTGTGGAATAGAAACCGAATAATGGTATTTTGGATTTGGTGGAGGTTGTCTGCCTCGTATTTTGTTGGCATAAATATCTT
GATCCAGTTGTGTGAAAACTTGTGTTGACTTGGTTTCTGGGATATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E648500] SGN-U617150 Coffea canephora Build 3 12 ESTs assembled
[SGN-E648500] SGN-U637331 Coffee species Build 1 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T472219 [Download] [View] Facility Assigned ID: cccs30w24n6.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15