EST details — SGN-E649365

Search information 
Request: 649365Match: SGN-E649365
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C449221Clone name: cccs30w34j3
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E649365Length: 20 bp (1059 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E649365 [] (trimmed - flagged) GCGCCACCCCGTTATTAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T473084 [Download] [View] Facility Assigned ID: cccs30w34j3.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: E. Coli (cloning host) sequence detected
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15