EST details — SGN-E650202

Search information 
Request: 650202Match: SGN-E650202
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C450058Clone name: cccs30w19g18
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C450058 [cccs30w19g18] Trace: SGN-T475048 EST: SGN-E651835 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E650202Length: 320 bp (1099 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E650202 [] (trimmed) CAGGAATTCGTTTCCAGGAATTCATCTTTTTCCTTTTCCAGCGATCTCCAATTGGGGTTGCTTCAAAAGAGGTTCAGATTAAAAAAAGTAGCTGA
AAGATGTGGAACTCTGGCCAGGTTGAAATGAAACATTCATCAAGCAGGACCCACTGTTGGCTTTCCCGAAAGCTATGGGAGAATTTTTCTTTTAT
ATTGCGCTACCTGATTTAATCTTATATGATTTCACATATGCTGATTCACGAACCAACTTAGTATTTCATCATTTGTTCCCTTTTGTCTTGCAATT
TTTTCTGAACTTGTTTACTGCCGGAGTTCTGTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E650202] SGN-U615590 Coffea canephora Build 3 7 ESTs assembled
[SGN-E650202] SGN-U633547 Coffee species Build 1 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T473921 [Download] [View] Facility Assigned ID: cccs30w19g18_1.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15