EST details — SGN-E651597

Search information 
Request: 651597Match: SGN-E651597
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C451113Clone name: cccs30w17i11
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C451113 [cccs30w17i11] Trace: SGN-T476054 EST: SGN-E654966 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E651597Length: 664 bp (980 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E651597 [] (trimmed) CAGGTACAAATGTCGTCGTTTTTGGTCGATCTTCAGGAGAGATTTTATCTACACTGAGTGGTCATTCGAGGAAGGTAACAAGTGTTAAATTTGTT
GCGGATGGGGAACTGTTGCTTTCTGGATCAGCTGATAAGACTGTTCGATTGTGGCAAGGATCAGAAGATGGCAACTATGAATGTAGGCACATCAT
GAAGGACCATGATGCAGAGGTGCAAGCAGTAACCGTTCATGCAACCAATAACTACTTTGTTACAGCTTCCCTTGACAACACGTGGTGCTTTTATG
ATCTTGCTTCTGGTCTATGCCTCACTCAGGTTTCCAATGGTTCAACAAATGATGGTTTCGCGTCTGCAGCTTTCCATCCTGATGGTCTCATCCTT
GGAACTGGCACTTCCGATGCTTGGGTTAAGATTTGGGATGTTAAAAGCCAGACAAATGTTGCCAATTTTGATGATCATCGTCATGGACCAGTTAC
TGGACCAGTTACAGCAATGTCATTTTCCGAGAATGGTTACTTCCTAGCGACTGCTGCCCATGATGGTGTCAGAATTTTTGATCTGCGTAAACTGA
AAAATTTCAGAACTTTTTCCCCTTATGATGAAAATACATCGACACGGTGTGTGGAATTTGACCATACTGAGAGCTACCTTGCACTTGGGGGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E651597] SGN-U616236 Coffea canephora Build 3 5 ESTs assembled
[SGN-E651597] SGN-U636193 Coffee species Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T474976 [Download] [View] Facility Assigned ID: cccs30w17i11_1.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15