EST details — SGN-E654077

Search information 
Request: 654077Match: SGN-E654077
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C403846Clone name: cccl6a16
nocartOrdering Not Available
Library Name: ccclOrganism: Coffea canephora

Tissue: LeafB
Development Stage: Young

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E654077Length: 679 bp (999 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E654077 [] (trimmed) GCAAGGATGTCTTGAAGTTGGTTCTTGGGAAACATAATTTGACCTCAGCTATTTCAGCTTACACTCGTACAGAAGTCGTGACTAAACAGCAATCT
TACTTTTTTTCCCACTCTCTGAAAGCAATATCCACAACATCCACAGCTAAAGGCATAACTTCCAAACAACTACTTATTGGCACTGTTGGTGATCA
GTTTTTTGTCTTGACACTTTATAGGTTTTGGCACTTGATAAACGTTTCTTGGATCCTCGGCGAACACTTAACCCCACACAAGCTGAGAAAGAGGA
AGGAATTATACCGCTTACCGATTCATTACCAATCATTCCACAGTCTTACGTGACGCATGCCCTTAAGGTGGAAGGCCTTAGAGGCATAGTAACTG
TCCCTGCGAAGTTAGAGTCAACTACTCTCGTCTTTGCCCATGGGGTGGATCTCTTTTTTACCAGGCTTGCACCTTCGAAGACCTATGATTCTCTT
ACTGAAGACTTCAGTTACGCTCTCCTGCTCATTACAATTGTTGCACTTGTGGTGGCTATATTCGTGACTTGGATTTTGTCAAAAAGGAAGGAGCT
GCAGGAGAAGTGGAGATGAAAGCTCTAATCTTATTTTTTGCAGTTACACTAGTTTTTCCTTTTAGATTCTTATTGGGTCTTTCTTTTTTGTTCTT
TATTTTGAAAGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E654077] SGN-U616473 Coffea canephora Build 3 7 ESTs assembled
[SGN-E654077] SGN-U629368 Coffee species Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T427709 [Download] [View] Facility Assigned ID: cccl6a16.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15