EST details — SGN-E658679

Search information 
Request: 658679Match: SGN-E658679
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C407461Clone name: cccl23a14
nocartOrdering Not Available
Library Name: ccclOrganism: Coffea canephora

Tissue: LeafB
Development Stage: Young

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E658679Length: 348 bp (1097 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E658679 [] (trimmed) TCGGACAAGAATTTGTAGTTATGATGGGAAGCAAAGCAAAAGCAATGGGGTCTGGGCTGACTCCTCTTCTTGCCACTGTTTTAGTGGTGTTTGTT
GCTCTTGGCTTGCCCTCACAAACTGCAGCTGATGATCACTACTACAAGTATTCATCTCCTCCTCCTCCTTACCACTATCCCTCACCACCACCTCC
AGTGCATATACCTCCACCTCATCCTGTTTACAAGTACAAATCTCCACCACCCCCACCACCACACCCAGTTTATTAGTATAAGTCACCACCACCAC
CTCCTCAGTGCCGGGTAACCACACCCAGTTCCTCATCCGGTGCCACACCCAGTTCCTCATCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E658679] SGN-U617361 Coffea canephora Build 3 29 ESTs assembled
[SGN-E658679] SGN-U637534 Coffee species Build 1 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T431324 [Download] [View] Facility Assigned ID: cccl23a14.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15