Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E662783

Search information 
Request: 662783Match: SGN-E662783
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C453706Clone name: cccs46w8n10
nocartOrdering Not Available
Library Name: cccs46wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 46 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E662783Length: 779 bp (1189 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E662783 [] (trimmed) GAAGTTCATCCATTGGACTTCTTTACAAACTGTGGGAAGATTCGTTTCTATTGCTGGGATACAGCTGGACAGGAGAAATTTGGTGGGCTTCGGGA
TGGATACTATATCCATGGACAATGTGCTATAATCATGTTTGATGTAACAGCTCGATTAACGTACAAGAATGTTCCTACGTGGCACCGTGATCTTT
GTCGGGTTTGCGAGAACATACCAATTGTACTTTGTGGAAACAAGGTTGATGTGAAGAATAGGCAAGTGAAGGCAAAGCAGGTTACCTTCCACCGC
AAAAAGAACTTGCAGTACTATGAGATTTCAGCAAAGAGCAATTACAACTTTGAGAAGCCTTTCCTATATCTTGCAAGGAAACTCGCTGGGGACCC
TAACTTGCATTTTGTCGAGTCCCCTGCCCTTTTACCCCCCGAGGTTCAGATTGACTTGGTTGCACAGCAACAGCATGAGGCTGAGCTTGCTCAAG
CTGCTGCTCAGCCACTCCCTGACGACGATGATGACACTTTCGAGTAAGGAGCAGCTGGATGGAGCTTGGAGTGCCTCTGTTATGGAATTTGTGGC
ATTTTTCATCGATAGGTTTCCTTGCCATCTATAGGTTTCCAGAATTTTGTCTCCATATTAGAAAGTATCGAGGGATTTTTCATCGATCAGTTTAG
GAATTTTCAAACTTCCTGATGTTTTGCCTTGATTTGTTTGTGAGAAGGACCCGCTGTGGTTACTCAGTTAAAGATACGGTGGACTATTGTTTGTA
TGAACTAAGACTGCATGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E662783] SGN-U617160 Coffea canephora Build 3 17 ESTs assembled
[SGN-E662783] SGN-U637121 Coffee species Build 1 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T477569 [Download] [View] Facility Assigned ID: cccs46w8n10.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15