EST details — SGN-E669132

Search information 
Request: 669132Match: SGN-E669132
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C457799Clone name: cccs46w20d22
nocartOrdering Not Available
Library Name: cccs46wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 46 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E669132Length: 1273 bp (1273 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E669132 [] (trimmed - flagged) CCGCGGGGGGCACGAGATACTAAGGATCCCCCGGGCTGCATGAATTCGGCACGAGGATAAACCCATCTCTGTCTATGCTTGTGCGAAATTTACTT
AATTAGATTCAAGATTATTTTAATCCCACTTTTCCTATTAGAGTGGAACTGGGCACCAAAACATATTTCAGAAGTCTAAGGACAGTGGTGCGAAT
TTATTATTCTCCTGCAAATTTTGAGCATGTGAAATTCTTAACCTTTAAAAGGTAGATTTCTACCAAAGACCTTTTCATGATGGAGAAATGATATT
TAGGCGCAAGGATGTGCAACAATGACATTTCTATAGAAGGCTGATAACTGGATATTGACGCACCTATTGTCTGTTCGGATGGTTGGAATGCTGCC
ACGTATATGATGGATATTAAATGCAAGGACGCTGAGTTGACCCTGTGATTATCTCCCCATTTCTTGTGATACATTTTAGAAATCATCTTGATCAT
GTTTCCTGCTCCCTTTTCTAGGGGATTTCAAGTTCGTCTAATGAAGGAAGTGTACGGATATCCACTCTAACAACTTTACCAAACTCTTCCATACC
ACATGGGTGAATGTTAGCTTGCCGATTACGATTGGTAGGTGACAGTAAGTCATAACATATGCAGATGTGGTTACTATACGTCCAAGTGCAGTCAG
GAACCCGTACTGGCCCATGCACAGAAATTTCATGAACCACTAGGGAGGCGGACCATTCCCGAATTAAAACTATTTCCGAAAAGGCTGTCTAACTC
CCAGAGATGCTTTACACAAATCCTGGATTTAATCCGAAGGTCTACTAAACATATGTTTTAGAAGCTTCCTCATGCTCTGTGAGGAGATATATTCG
GCCAAAGGCTTCCTTAGTAATCTCCCAAATCTCTTCACAGTAGATAACGCTGAAAAAATGGATAGACTGTTTATGACGTACATCGTGAATTGCCA
GTATACGTAGTAAGGAGTTTCCTAACCTCATACGGCAAATGGCGAATTTTATCTGGTCCTAAAAACGTGTAAAATTCTCTATATCATACAGGGCG
GATGGATTTCGATCTTCAAGCCCCCTTTCCCTCACTTAAAAACGGAGACTATTAACGCTAGATCTGTTTACCTGACTAATCCCACTCTGAGATAA
AATTTCCTAGGAAACAAACGGGCACCTGCCAAATAATCTATTCACATGTCATAAAGGGGAATCTCCCTTGTAGCGGTAAAAAGTGCTGCCCTCTA
TATATCTAGACATCTACGCCTCTTCCTTCAGAAAGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T481662 [Download] [View] Facility Assigned ID: cccs46w20d22.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: High expected error (low overall quality)
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15