EST details — SGN-E676536

Search information 
Request: 676536Match: SGN-E676536
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C427231Clone name: cccwc22w12l2
nocartOrdering Not Available
Library Name: cccwc22wOrganism: Coffea canephora

Tissue: Whole Cherry
Development Stage: 22 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E676536Length: 297 bp (1258 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E676536 [] (trimmed) GAATATGGACCTGTTTCACCAAGAGCCCCACCGGCGAGTAAAGAAGTGGTGGGAAAGCTCCCAGTTACTGCTGTTATCGGCTATGTCTTGACCAT
CCTGGGTGCGGATAGTGAGTGCGCCATTTGCACTGAGAGCTTGGTGCTGAATGACAAGATGCAAGAGTTGCCTTGCAAGCATATCTTTCACCCTC
CCTGCCTTAAGCCCTGGCTGGATGAACATAATTCTTGTCCAATCTGTCGGCATGAGCTGCGAACGGATGATCATGACTACGAAAGTTGGAAGGAG
CGAGAGAAGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E676536] SGN-U621106 Coffea canephora Build 3 1 ESTs assembled
[SGN-E676536] SGN-U640590 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T451094 [Download] [View] Facility Assigned ID: cccwc22w12l2.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15