EST details — SGN-E686655
| Search information |
| Request: 686655 | Match: SGN-E686655 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C437346 | Clone name: cccwc22w24p5 |
| ||
| Library Name: cccwc22w | Organism: Coffea canephora |
Tissue: Whole Cherry
Development Stage: 22 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E686655 | Length: 179 bp (1231 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E686655 [] (trimmed)
GGTAGTGTGATTGTTTGGGAGTTTCCAGTTAATGTAGTTTTAGTAATACAGTCTCACCTTGTGATCTAGACGAAGATGTTTCTTCTTTACTTTTC
CAAACTTGAGCATATTTGCCTTGGTTTATCAAGGCTTGACGATCACTGAGTTGAATGTAGACCCTTTTGCCCTTGTTTGTATAA
CAAACTTGAGCATATTTGCCTTGGTTTATCAAGGCTTGACGATCACTGAGTTGAATGTAGACCCTTTTGCCCTTGTTTGTATAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E686655] | SGN-U617407 | Coffea canephora | Build 3 | 13 ESTs assembled | |
| [SGN-E686655] | SGN-U637151 | Coffee species | Build 1 | 6 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T461209 [Download] [View] | Facility Assigned ID: cccwc22w24p5.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
