Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E687914

Search information 
Request: 687914Match: SGN-E687914
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C464920Clone name: T3_tus_81_J23
nocartOrdering Not Available
Library Name: t3_tusOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E687914Length: 855 bp (1046 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E687914 [] (trimmed) GAAACCCCACTGTGCTGGGTACTAAACCCAAGGTCTCAAATGGCCACTCAGCTGTGCTTTTAAATGGTGATCGTATATTGGTTATTAAGGGCAAT
TCCAAGTCTGATGAATGCTTTTGGTTTCTTGAGGTCTGTTAATTTATGGCCTTTAGATAATTAAACGTTCTTATTATGTCTGTTAAACTTGGACG
TCAGGATCTCATGCTGAATCTGTGTTGATTGCTCAGATCAGCATTCCTCCTAATGTTTAATTGGAGATGCCGGTGGGTGGATCACTGGAGTTCCC
TGTTTGTACTTATCCATCCTAATTAGGAAAAAAGTAAAAAATGTGATTATCGAGAGACAATTAACAGTTTGAATATCATTCGGTACCCTTGAATG
AGTTTAATTTGCTGGCACTCACTTTTTCCAAGTTATGCTAAAAATTGTTACATACATTTTGTAGGTGGGCACCTCATTTATAAGAGAACAGGAAA
AGACATATGGAACTGAGGTGGTTGCCTGGAGTAAGGGAGTTTTAGGTAATGTGGAGAAGCCTATTGTCATTAGTGGCCCTTCTGGAGTGGGGAAG
GGTACCTTGATATCTGAACTAATGAAAGAGTTCCCATCTATGTTTGGATTTTCTGTGAGCCACACGACCCGGGCCCCAAGAGAAAAAGAGCAGAA
TGGATTTCATTACCATTTCAGTGACCGCAGTGTAATGGAGAGAGAGATAAAGGATGGGAAATTCCTGGAGTTTGCTTCTGTTCATGGTAATCTTT
ATGGAACCAGTGTCGAAGCAATTGAGGTGGTTGCTGATGCTGGCAAGCGATGCATCCTTGATATTGATGTTCAAGGTGCAGGGTCTGTGAAAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E687914] SGN-U568367 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T489924 [Download] [View] Facility Assigned ID: T3_tus_81_J23
Submitter: None Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5