EST details — SGN-E687965

Search information 
Request: 687965Match: SGN-E687965
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C464971Clone name: T3_tus_81_N14
nocartOrdering Not Available
Library Name: t3_tusOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E687965Length: 807 bp (1121 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E687965 [] (trimmed) CAACAGGCAAGTAACTTATTCAAAAAGAAGAAATGGTATAATAAAGAAAGCTAAAGAAATTACTGTTCTTTGTGAAGCTAAGGTTTCACTTATAA
TCTTTGCTAGTTCTGGAAAGATGCATGAATATTGTAGCCCTTCTACTACGATNAGTGATATGTTGGATGGTTATCAAAAAGCTTCTGGGAGGAGA
CTATGGGATGCTAAGCATGAGAATTTGAGTAATGAAATTGATAGAATCAAGAAAGAGAATGACAGTATGCAGGTTAAGCTCAGGCACCTCAAAGG
AGAAGATATCAATCAACTTACCCATAAAGAGCTTATAATTATGGAAGAAGCCTTACAAAATGGACTTTCTAGTATCAGTGCCAAGCAGTCTGAAA
TCTTGAGGATGGTCAGGAAAAATGATCAAATTCTGGAGGAGGAAAATAAGCAACTTCAATATGCTTTGCACCAAAAGGAGATGGGAGCCATTGGT
GGAAGTGGAAATATGAGAGGAATTCATGAAGAAGTGTATCATCAAAGAGAAAGGGATTATGAGTACCAAATGCCATTTGGCCTACGAGTTCAGCC
AATGCAGCCNAATCTACATGAAAGAATGTAAAATTATATTAATTCCCACTTTAAATTAAGAACTCTAATAATTTTAATTTGGGTTTCTACTATAG
CTAGAAACACTAATTAATCAATTCTAGTTATATGTAATGAGTATTAGCTAAGACTTTGTTTCATGTTGGAATTATTACCTAATTTTATGGGCTCT
TCCCATGGTTTTAATTAAGTACTGAAATGTAGTGACATATTTATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E687965] SGN-U573183 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T489847 [Download] [View] Facility Assigned ID: T3_tus_81_N14
Submitter: None Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5