EST details — SGN-E688226

Search information 
Request: 688226Match: SGN-E688226
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C465232Clone name: t3_tus_11_e14
nocartOrdering Not Available
Library Name: t3_tusOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E688226Length: 613 bp (837 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E688226 [] (trimmed) CTTAAACCCCCCCAAAAACCATATGTCGGCCTTTATAAACAATTATTTCACCCAATGCACCACTATGGATATCCAAAAATACTGTGACTTACAAT
TCTCTTAGGGGAGGACTTTGTATGACGGGAAACCTGAACAAGAGCCTGCAATTTGTCCAAAAGCTCATTCAGAAAGGGTTGGTACCAAATGCATA
TACGTACTCTATATTGCTTGAGGCTAGTTATAAAGAAAAAGGGGTTAATGAAGCAATGTTACTTTTAGACAATATTATTGCCAAGGGTGGAAAGC
CTAATTTGGTTAGTTACAATGTTCTCTTAACTGGGCTGTGCAAAGAAGGAAGAATAGATGAAGCTAAACAATTCTTTAGAAACTTGCCATCAAAA
GGGTTTAATCCTAACGTTGTCAGCTATAATATCTTGTTGAGGAGCTTGTGTTTTGAAGGACGTTGGGAGGAAGCCAATGAGTTTCTGGCAGAGAT
GGTTGGAGAAGATCGTTCTCCATCGATTGTAACGTACAATATATTGATCAGTTCGCTTGCTCTTCATGGGCAAACGGATCATGCTATCAAGATTC
TGGATGAAATGTACTTTGCAGAACAGTTCAAGCCAATTGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E688226] SGN-U567406 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T489683 [Download] [View] Facility Assigned ID: t3_tus_11_e14
Submitter: None Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0093 Quality Trim Threshold: 20.5