EST details — SGN-E688832

Search information 
Request: 688832Match: SGN-E688832
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C465838Clone name: t3_tus_54_j14
nocartOrdering Not Available
Library Name: t3_tusOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E688832Length: 237 bp (677 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E688832 [] (trimmed) TGGAATGCACAAGGAACAACAGTCGGACACTATAATCACAATTATTAGAAGCCACATCACCTCCAGTACTAGATACAGTTAAATATGTGACAGGA
CAATTTCCTCTAGAATGACTTTTGGTAACAAAGTTTAGCTACACATGATTATTGTAAACTGTTTACATTACCAATATTACAAGTCTTCAGAAGGC
ACCTCTTCTGGATTGATCGCGACATCAGGCATTGATAACTCTGTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E688832] SGN-U562775 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T488652 [Download] [View] Facility Assigned ID: t3_tus_54_j14
Submitter: None Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.909 Expected Error Rate: 0.0317 Quality Trim Threshold: 12.5