EST details — SGN-E689067

Search information 
Request: 689067Match: SGN-E689067
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466073Clone name: t3_tus_55_P10
nocartOrdering Not Available
Library Name: t3_tusOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E689067Length: 573 bp (807 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E689067 [] (trimmed) TTAACCGCCCGGGGCGGCTTTTAAAAAATGAAATTTTCGCATCATCTGATGAGCTTTTGTTTATGAAGCGTGGAGGAGAGCTCATTTATGCCGGA
CCTCTTGGGGGGAGATCTTGCAAGTTGATAGAGTATTTTGAGGCAATTGAAGGAGTACCCCCAATAAGACCTGGATATAATCCAGCTACATGGAT
GTTGGAGGTTACTTCGTCAGTAGAAGAAACTCGACTTGGTGTTGATTTTGCAGAAATTTACCACAGATCAAACCTTTTTCAATATAATCAAGTTT
TGGTTGAAAGGCTAAGCAGGTCACGTGGCGATTCGAAAGATTTGAATTTCCCTGCTAAGTATTGTCAGTCCTATTTCAGTCAGTTCCTAGCTTGC
CTTTGGAAGCAAAATCTCTCATATTGGCGCAATCCACAATATACTGCTGTTCGCTTCTTCTATACGCTCATCATATCTTTGATGCTTGGGACAAT
TTGTTGCAGATTCGGATCATAAAGGGATTCCCCGCACGATTTATTCAATGCAATGGGATCCCTGTATGTTGCAGTGTTGTTCGCTGGAGTTACAA
TGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E689067] SGN-U581927 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T489142 [Download] [View] Facility Assigned ID: t3_tus_55_P10
Submitter: None Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0094 Quality Trim Threshold: 20.5