Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E689350

Search information 
Request: 689350Match: SGN-E689350
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466356Clone name: t3_tus_84_E17
nocartOrdering Not Available
Library Name: t3_tusOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E689350Length: 712 bp (1186 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E689350 [] (trimmed) CAGGAATCAATCAATCTTCTGCCTGTGTGTTCCATATTGTGTTTGACGGAAAAATGGACGATGATTTTGGTATTCCACCGGTCGAGGGAATGGAC
GAGGACATGGATCTGCCGGAGGACAGTTCGACCATGAAAGTAGGCGAGGAGAAGGAAATTGGAAATCAGGGATTGAAGAAGAAGCTTGTTAAGGA
AGGTGAAGGTTGGGAAACTCCTGAGCCTGGTGATGAAGTCGAAGTTCATTATACTGGAACTCTGCTCGACGGAACCAAGTTTGATTCCAGCCGCG
ATAGAGGGGACCCCTTCAAGTTTACTCTCGGTCAAGGACAAGTAATTAAAGGATGGGATCAAGGTATAAAGACAATGAAGAAAGGTCCAATTGAC
AGTGAAGCCACAATATGGCTTCGGAGAGAAAGGAAAACCAGCCTCGAGTGATGGAGGAGCAGTTCCTCCTAATGCCACATTACAGATCAACTTGG
AGTTGGTCTCCTGGAAAACTGTTTCAAATGTTACTGATGACAAGAAAGTAGTAAAGAAGATCTTGAAAGAAGGGGAAGGATATGAGAGACCCAAT
GAAGGAGCTGTTGTTAAATTAAAACTGGTTGGCAAGCTGCTAGATGGCACAGTCTTCACAAAGAAGGGCCATGATGGGGAAAGTGAAGATAATTC
TTTTTGAGTTTAAGACAGATGAGGAACAAGTAATTGATGGGCTGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E689350] SGN-U567761 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T488899 [Download] [View] Facility Assigned ID: t3_tus_84_E17
Submitter: None Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5