EST details — SGN-E689785

Search information 
Request: 689785Match: SGN-E689785
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466791Clone name: LH_Ea01M23
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C466791 [LH_Ea01M23] Trace: SGN-T493751 EST: SGN-E693625 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E689785Length: 755 bp (986 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E689785 [] (trimmed) TGCCAGATGACAACTCCGCCTTAAAACCGCCAAATGTCTATGGAAGTATTGAGTTGAAAAACATTGATTTCTCATATCCATCTCGACCAGAAGTC
CTGGTACTGAGCAATTTCACTCTAAAAGTCAACGGAGGGCAAACTGTAGCTGTGGGGGGGGTTTCCGGCTCAGGAAAGAGCACTATTATATCTTT
AATAGAGAGGTTTTATGACCCTGTTGCTGGTCAGGTTTTACTTGATGGCCGTGATTTGAAGTCATACAATTTACGATGGTTGAGGAACCACTTAG
GACTTGTTCAGCAGGAACCAATTATCTTTTCAACCACCATTAGGGAAAACATAATCTATGCAAGGCACAATGCTAGTGAAGCTGAGATGAAAGAA
GCCGCTAGAATAGCAAATGCTCATCATTTCATCAGCAGTTTGCCTCATGGTTATGACACACATGTTGGGATGAGGGGGGTAGATCTGACTCCTGG
GCAGAAGCAAAGAATTGCAATAGCTCGTGTTGTTCTGAAGAATGCACCTATTCTGTTATTGGATGAAGCAAGCTCCTCCATTGAATCTGAGTCGA
GCCGAGTGATACAGGAGGCTCTTGATACTCTAATCATGGGGAACAAGACAACTATTTTAATTGCCCACCGAGCTGCCATGATGAGGCATGTTGAC
AACATAGTTGTACTTAATGGAGGGAGGATTGTTGAGGAAGGTACCCACGATACACTGATGTCAAAAAATGGTTTGTATGTCCGCCTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E689785] SGN-U585462 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T497684 [Download] [View] Facility Assigned ID: LH_Ea01M23.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5