EST details — SGN-E690353

Search information 
Request: 690353Match: SGN-E690353
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467359Clone name: LH_Ea03E15
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C467359 [LH_Ea03E15] Trace: SGN-T493297 EST: SGN-E694193 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E690353Length: 586 bp (1028 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E690353 [] (trimmed) CCGCGTTTTTTTTACAACAACAAAAAATGGCGAAGATAAATGTCATGATAGCCGTTGTCGTGCTTGTTGTATCAGTAATGTCAATTGAGCAAGCC
ACAGCAGCTCGACGTCTTCAGCAATTTGGTGGTTTCCCTATGCCTACTACTCCATCAACTGGTGGTGGTTTCCCCTCATTTCCTATGCCTACGAC
TCCATCAACTGGTGGTGGTTTCCCCTCATTTCCTATGCCTACTACTCCAGGTTTTCCTACTCCATCAACTGGTGGCGGCGGCTTTGGTGGGCTGC
CTAGTTTTCCATTTCCCCCATTCCCCAACACTCCAGCTGATGCCACACAAACCACTACTCCTTGAAATGTAACTTCATACACACGACTCTCAACT
ATCCATATCTTTCTGATCCCCCCTTATAATTAACTTCTGATTGATGTATTTCTATTGTTTAAATTAAAATTGCTTACTGAAGCAATTGTTGCTTA
ATGTTTGTTGTTATTTATGTAACTAAGCTATGTACTGATTATTCGTTGTTTCATTCAATACTACTAGCTTCATTTATCNTAAAAAAAAAAAAAAA
AAAAACAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E690353] SGN-U582571 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T497522 [Download] [View] Facility Assigned ID: LH_Ea03E15.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0059 Quality Trim Threshold: 12.5