EST details — SGN-E690628
| Search information |
| Request: 690628 | Match: SGN-E690628 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C467634 | Clone name: LH_Ea04A02 |
| ||
| Library Name: LH_Ea | Organism: Solanum habrochaites (formerly Lycopersicon hirsutum) |
Tissue: Glandular Trichomes
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C467634 [LH_Ea04A02] | Trace: SGN-T493028 | EST: SGN-E694468 | Direction: 3' | Facility: AGI |
| Sequence |
| Sequence Id: SGN-E690628 | Length: 190 bp (1015 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E690628 [] (trimmed)
TTCTCGTGCCGAATTCGGCACGAGGGGAGAGTGATCTCTACTAGTTAAATCCTATGTCAAAGCAAAGGTAAAAACAGCTAGATATTGCTTTTTTT
CCCCCTCTAGTGTCAAAACTAAGGTTCAATCATGAACTTGTTTTGTTTCATAAATTGCTTTATGTAATGAAGTGTTTTTCTTATAAAAAAAAAAA
CCCCCTCTAGTGTCAAAACTAAGGTTCAATCATGAACTTGTTTTGTTTCATAAATTGCTTTATGTAATGAAGTGTTTTTCTTATAAAAAAAAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E690628] | SGN-U569608 | Tomato 200607 | Build 2 | 37 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T497247 [Download] [View] | Facility Assigned ID: LH_Ea04A02.f |
| Submitter: Eyal Fridman | Sequencing Facility: AGI |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.937 | Expected Error Rate: 0.0064 | Quality Trim Threshold: 12.5 |
Working
