EST details — SGN-E691213

Search information 
Request: 691213Match: SGN-E691213
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468219Clone name: LH_Ea05I11
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468219 [LH_Ea05I11] Trace: SGN-T492369 EST: SGN-E695053 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E691213Length: 428 bp (1022 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E691213 [] (trimmed) CGTGACCTCGAACCATGTCTTGGTTTTGTGTTAAATGGTGGACCTACCGTGCCTTCAGCATGTTGTGGTGGGCTTAAATCTCTACTCGTTGCTGC
GGGTACCACAGCTGACCGTCAAAGCGCTTGCAAATGCATAAAGAGCCTTGCTTCAAGTGCTAATGGAGTTCAAATTGGCCGTGCTACACAACTCC
CTGGAATATGTAAGGTTAATGTTCCTTACCAGATTAGTCCAAATGTTGATTGCTCAAAGATCACATAACACATTTTCTATGAATTTATTTTAGTG
GGAGAATGGGATATTTATGTCCCTTTATTTCCTATTAAATAAAACTACAATAATAATATCACATTTTGTATGCTTTCTTATTTTACCAATTAGTC
AAAATTTGCTATTTGAATAAATAATTTCTTTTCCCTTAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E691213] SGN-U582694 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T496215 [Download] [View] Facility Assigned ID: LH_Ea05I11.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0012 Quality Trim Threshold: 12.5