EST details — SGN-E691328

Search information 
Request: 691328Match: SGN-E691328
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468334Clone name: LH_Ea05N06
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468334 [LH_Ea05N06] Trace: SGN-T492201 EST: SGN-E695168 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E691328Length: 382 bp (1146 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E691328 [] (trimmed) TTTTAAACCTGAGAGATTTTTGAATTTGGATCTGGACATGCGAGGACAAGATTTTGAGTTGATTCCATTTGGTGCTGGACGAAGAATATGCCCTG
GGTTGCCACTAGCATTGAGAATGATTCCATTAATGTTGGGCTCACTCTTGAATTCATTCAATTGGAAACTTGATGCAGGTATTGAGCCACAAGAA
TTAGACATGGAGGAGAAGTTTGGTATTACCTTAGCCAAAGCTCATCCTTTGCGAGCTATCCCCTCTCCTCTTTGATCGATGTTGCATTGCCTAGT
CGATAAATATTTATATGTATTTGATATTTACGCTGAAGCAAGTATTTTAATCTAAATAATCATATATATATATATATTGCCTATAAAAAAAAAAA
AA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E691328] SGN-U577055 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T496100 [Download] [View] Facility Assigned ID: LH_Ea05N06.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0005 Quality Trim Threshold: 12.5