EST details — SGN-E691596

Search information 
Request: 691596Match: SGN-E691596
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468602Clone name: LH_Ea06I10
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U575006 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E691596Length: 725 bp (1193 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E691596 [] (trimmed) CGTCACCGACTGTTATAATAAGAACTTATCTGGATGTCATGTTGAACAAAGAGTGTTCAAGGATCTATTAACCAAAAAATGTCCAAGGATAACCG
CTCATTTGGAGGCACTGGAGTTCGACGTTTCTCTTGTTTGCACCGAATGGTTTCTCTGCCTTTTCGCCAAAAGCTTGCCTTCTGAGACAACCTTG
CGGGTCTGGGATGTCCTTTTCAATGAAGGTGCAAATCTTCTATTTCATGTGGCATTGGCAATTTTTAAGATGAACGAAGAAGAGTTGCTGACGGT
GCATCATGTTGGGGATGTAATTCATATAATCCAGAGATGCACACATCAACTTTTTGATCCTGATGACTTGTTGACGGTTGCTTTTGATCAAATTG
GTTTTATGACAACCACTACTATATCAAGACAGAGGAAAAAGCAGGAACCAGCGGTCATGGCAGAGCTTGACCAGAGACTAAGGCGGTTAAATTCC
ATAAACGCGAGTGATGAACAATAGTTTTGTGATGGAAACCTTATAATTGTAGTATATATATATATATACATGTTGTATCTCTATCAGGGCATGCT
GCCCTTATAGGACATCACAACCCTTGTGCTCATAATGCAATGAGCTAAACAACAGCTTGGAGAGTCCTGTTGTGTTTATTTATGTTGATAGATCT
TCAAAAGTGTAAATTTTGAACTGTTGTATACTAGTCCTATATTATTTCCCCTTGTTTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E691596] SGN-U575006 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T495894 [Download] [View] Facility Assigned ID: LH_Ea06I10.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0019 Quality Trim Threshold: 12.5