Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E691675

Search information 
Request: 691675Match: SGN-E691675
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468681Clone name: LH_Ea06L17
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E691675Length: 812 bp (1123 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E691675 [] (trimmed) TTCTACCCCATCATCTTCATCTGGAAACAAAATTAGTCCCGCTGTTCTTTTTATCATAGTAATACTAGCTATCATATTCTTTATTTCTGGTGTCC
TGCATTTGTTAGTTAGGTATTTGATGAAACATAGGTGGTCTTCTTCTTCATCTAATAGAGATCCTGAAATGTCTGATTCTGGTACCTATCAAAGG
CAGTTACAACAGCTTTTTCATCTTCATGACTCAGGTTTAGATCAGGCTTTTATTGATGCTCTCCCTGTGTTTCTTTATAAAGAAATTGTGGGTTT
GAAGGAGCCTTTTGATTGTGCTGTTTGTCTTTGTGAGTTTTCAGAACAAGATGAATTGAGGTTGCTCCCTTTATGTAGTCATGCCTTTCATATAA
GTTGTATAGATACATGGTTGTTGTCAAATTCAACTTGCCCCCTTTGTAGAGGAATCCTTTTCACACCAGGTTTTTGTGCTGAAAATCCAATCTTT
TGCTTTGATGATTCAATAAGAGATGAATGTAGTAATGGTGGGGTTTCAGAACATGGAAGTGTTGTTGGTGTTGGTGTTTCTCCTAGCGTAAAACC
ACATGAGGATTTAGATAGTACTATTAGTTCAAGAAGGGTGTTTTCAGTAAGACTTGGCAAATTCAAGAACACAAACAATAGTCTTGTTGAAAATG
GAAAAAGGGAAATGGGAGAGACTAGTAACAGTAGTTTGGATTCAAGAAGGTGTTTTTCAATGGGGTCTTTTCAATATGTGGGGGATGATTCAAAA
TTACAAGTGGCATTATGTCCCAATAGTGCTAAAAATCATGGTGTTGATGGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E691675] SGN-U564469 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T495753 [Download] [View] Facility Assigned ID: LH_Ea06L17.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5