EST details — SGN-E691747

Search information 
Request: 691747Match: SGN-E691747
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468753Clone name: LH_Ea06O17
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468753 [LH_Ea06O17] Trace: SGN-T492288 EST: SGN-E695587 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E691747Length: 803 bp (1103 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E691747 [] (trimmed) ACCATGATTTTGAAGTACACTTTCTCCCTAAAACCCACAACCCTTCTTTTCTCTTCTTCTACGTAACTCATACGCTCAATTTCTACAAATATATT
TGCTTCAAATAACTGTATTGTGGTTCTCTGATCTTCTTCTGATTCGATGTCGGCTAGAACAGTGAAAGTGAGCAATGTTTCTCTGAGTGCATCGG
AGCAAGATATCAAGGAGTTCTTTTCATTCTCCGGGGATATTGAATATGTTGAGATGATGGGTGAGAATGAGCGATCTCAAATTGCATATGTCACA
TTCAAGGATCTCCAGGGTGCAGAAACTGCAGTTCTTCTTTCTGGAGCAACAATTATTGATCAGTCGGTCACAATAGTACCTGAACCTGACTACGA
GCTGCCTCCTACAGCTCTTGTGCCAATCAAGGCAACTGAGAGTGCTAATGCAGCTGGTGGTGGATCTGCTATTCAAAAGGCAGAAGATGTTGTGA
GCAGCATGTTGGCAAAGGGCTTCATCCTGGGCAAGGATGCAGTTAACAAAGCCAAGACTTTTGATGAGAAACACCAGTTCACATCCACTGCCTCT
GCAAAAGTTGCTTCTTTAGACCAAAAGATTGGCCTTAGTGAGAAAATCAATTTGGGAGCAACGATTGTGAATGACAAAGTGAAAGAAATGGACCA
GAAGTTCCACGTTTCTGAAAAGACAAAATCTGCTATTGCAGCTGCTGAGCAGACGGTTAGCACTGCTGGATCTGCCATCATGAAGAACAGATATG
TGTTGACAGGGGCATCTTGGGTTACTGGTGCTTTTCATAAGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E691747] SGN-U580662 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T495681 [Download] [View] Facility Assigned ID: LH_Ea06O17.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5