EST details — SGN-E692791

Search information 
Request: 692791Match: SGN-E692791
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469797Clone name: LH_Ea09K05
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469797 [LH_Ea09K05] Trace: SGN-T490812 EST: SGN-E696631 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E692791Length: 610 bp (1134 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E692791 [] (trimmed) TTGCTCCTCTCTCCTTATCCATGGCGTCTACATTCCTTACATTGGCTAAACCCTTCGCTTCTCACTCAACAAATCTTCCTTATTTCTCTCCTCAA
AGACCCATTGGTCTGAAAAGAAATTCCTTGAGAATTAATGCCATTTCCCAGAAATGGGAACCCACAAAGGTTGTGCCGCAAGCTGATAGAGTTTT
GATTCGGTTAGAGGAATTGCCTGAGAAATCTGCTGGTGGAGTTTTGCTTCCGAAATCGGCAGTGAAGTTTGAGCGTTATCTTATGGGAGAAGTTC
TTTCTGTTGGTTCTGACGTTGCTCAAGTAGAGACGGGGAAGAAGGTTCTTTTCTCTGACATCAATGCTTATGAGGTGGATTTGGGAACTGATGCA
AGGCATTGTTTCTGCAAGGAGAGCGAGTTGCTGGCTTTGGTTGAATGAAGTCTCTCCCATTTGAATTATTAGGGCGCTAAGTTTTGTCAGTTTCT
TAGCCAAAAGACATTTAGACTGCGGGATGTGTTGTAAAATCCCTTCTTTTGTAACACAAAAATATTGAGATATGTTTATTGGATATTTTCCTGAT
GATTTATGGGAAGAAGTATTGAGATTGAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E692791] SGN-U580696 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T494601 [Download] [View] Facility Assigned ID: LH_Ea09K05.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0012 Quality Trim Threshold: 12.5