EST details — SGN-E692792

Search information 
Request: 692792Match: SGN-E692792
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469798Clone name: LH_Ea09K06
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469798 [LH_Ea09K06] Trace: SGN-T490811 EST: SGN-E696632 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E692792Length: 818 bp (1130 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E692792 [] (trimmed) CCGTAAGATAGAGAGAGAGAGAGGTGATACCATTGATCAGAGGAGGTCCCAAAAGTAACGTTATATTCAATTCCAAGATTGATTCCTCTTTCATT
ATCATCATTCATTGGAAGCTCCGGAGGTGATATCTGTTACTTTGGATTGAATTTTAAGATAAACAAAATAGCCATGTATTCCGACCTGGTGGAAA
TTGCACCAAGGGAACTCAAGTTCGTATTTGAACCCAAGAAGCAAAGCGCTTGCACTATTCGACTAATCAATAAGTCCCAAAATCATGTTGCTTTT
AAGGTCAAGACTACCAGTCCAAAGAAATATTGTGTTAGACCAAATACAGGAACTATTAAGCCAAGAGCATCCTGTGATTTTACAGTGACCATGCA
GGCACAAAAGGCACCTCCTCCTGATATGGCATGCAAGGATAAGTTCTTAGTTCAATGCACAGTTGTGGCAGAAGAGACTGTTGAGGAGGATATTA
CATCAGCCATGTTTTCGAAAGATGATGGCAAATATGTTCAAGAAAATAAGATGAGAGTGGTTCTTGTCAGTCCACCTGGTTCGCCTATTTTATCA
CCAATCAATGTAGGACACAGTGATCTTCCAAGTAACATAGATTCACCGCGAGAAGATCAAGTACATGGTAATGAAAATATCAGTTCGCATCAAGA
AGGAGATGTCAATGGAGTACATAACCACAATGGAAGATACGAAGAAGCATTGACCAGAGATCAAGTAAACCCCCTCAATCAAAATACACAGAAGG
AACTGGATGAGAATGTAAAGGAGTTCAGAAAGGAAAATGCTGACATGCAAATGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E692792] SGN-U580721 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T494600 [Download] [View] Facility Assigned ID: LH_Ea09K06.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5