Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E693045

Search information 
Request: 693045Match: SGN-E693045
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C470051Clone name: LH_Ea10E19
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C470051 [LH_Ea10E19] Trace: SGN-T490591 EST: SGN-E696885 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E693045Length: 609 bp (1092 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E693045 [] (trimmed) CGTTTACGAGGCATGAAGACGCTGCATCTTCGTGTACAGCACCAAAATTCTACTGCATTGAGGATGGCCGAAATTTTAGAGGCTCATCCCAAGGT
GAAACACGTCTATTATCCAGCCTTGCCGAGTCATCCGGAATATCACCTTGCAAAGAAACAAATGACTGGCTTTGGTGGTGTGGTCAGTTTTGAGG
TTGATGGAGACCTCCTAACTACTGCAAAATTTGTGGATGCTCTGAGGATTCCTTATATTGCTCCATCGTTTGGAGGTTGTGAGAGCATTGTGGAC
CAACCAGCAATAATGTCTTATTGGGATCTTAGCCAGTCTGATAGAGCAAAGTATGGCATCTTGGATAACTTGGTCCGATTTAGCTTTGGAGTGGA
AGATTTTGAAGATGTGAAAGCTGATGTTCTTCAGGCTTTGGATTCCATTTAGGCTGTTTCACCTGCAACGATTTTTTCCTTTTCCTTTTCATCCT
GATTTCGTTGTTCGTACTTGTGTTATTGCTGACTTCCATCACGTATCCAATTGTTTGAACCTAATTAAAGGATCATCTAGTAGATGATTCAGTCC
ATTAAATTATTTCATGTCGTGTTCCTTAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E693045] SGN-U578164 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T494830 [Download] [View] Facility Assigned ID: LH_Ea10E19.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0031 Quality Trim Threshold: 12.5