Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E693104

Search information 
Request: 693104Match: SGN-E693104
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C470110Clone name: LH_Ea10H06
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C470110 [LH_Ea10H06] Trace: SGN-T490532 EST: SGN-E696944 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E693104Length: 372 bp (1209 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E693104 [] (trimmed) CGTTAAAAAGGGCGAATCGCGCAAAGTGGAGAGAGTTCTTGTTGTGTAAAGGGCTTGAGGATTCTTACATTGATGGTCTTGTGCAGAAGCTACAA
TGTCTACTCTGATTGCAGAACACTGTTTCGACAGCTCGAACCTGTAACTTTGTAACCTCCTAGGAGTTTGGTGCCAATAAAGTTCTTGTTGAGTA
AAAGACTTGAGGATTCTTACATTAATGGTCTTGTGCAAAAGCTACAATGTTTACTATGATTGCAAGAGACTGTTTCCACAGCTCGAACCTGTAAC
GTTGTAACCACCTCCTAGTAGTTTGCCAATAAGTTCTAGTTGCCAATAAAGTTTTAGATGTTTGTTTAAAAAAAAAAAAAAAAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E693104] SGN-U577789 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T494326 [Download] [View] Facility Assigned ID: LH_Ea10H06.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0069 Quality Trim Threshold: 12.5