Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E693566

Search information 
Request: 693566Match: SGN-E693566
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466732Clone name: LH_Ea01K12
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C466732 [LH_Ea01K12] Trace: SGN-T497743 EST: SGN-E689726 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E693566Length: 577 bp (1135 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E693566 [] (trimmed) TTTTTTTTTTTTACTGGTAAAAAGTGATAAATGGCTAAGAGCCATTTAGGCACCAATAAAAATGATCAAAAATCAAATATTCCACTTTAAGCAGA
TACTAAAAAGTAGATCATGGCAAAGCAGTTTCAGAACCTAACATTTCATATTGAGGGGTTAGCATACAACTCATTTCTTCTTTTCACCACCTCCA
GTAGCCCTCATTTTACGGAGAACACTGGACATCTCTTCACGCTTCTTCTTTGCTCTCTTGTGAGTACCCAGCTTCCTCTTGGCTACCTTAAGAGC
ACGTTTGTCCTTTCCAACTTTAAGAAGCTCAGTAATTCTCTTCTCATAAGGGGCAAAACCAGCTACTTCCCTGATAAGGCTTCTAACAAAATGTA
TTCTCTTACTGGTTTTCCCTTTTCTATCAGAAGGGCGGGGTGCCAACTCTTTCTTAGTAACAACATGTCCTTTGTTAAGACCCACAGAAAGGCCT
GTATTTGGCTGCTTTGGAGCCATCCCTAATCAGCTCCAACAGAACTTCGTTACTGGAAGAATTTTCACCAAGTACCTTTGACGGAAATAGTCGCC
GGAAGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E693566] SGN-U581074 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493810 [Download] [View] Facility Assigned ID: LH_Ea01K12.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5