Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E693660

Search information 
Request: 693660Match: SGN-E693660
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C466826Clone name: LH_Ea01O10
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E693660Length: 759 bp (1143 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E693660 [] (trimmed) TTTTTTTTTTTTTTTTTTAGACAAAACAAACAATAGACTCTATAGGGAGCATATTATTATGGCATACAAAGTAGAATAATGCGATAAACGAAGCA
CAAGAAACAACAAATAGCTAGCAACAACAATCGAAGAACAAGAAACTACGAGAATAATGCTAAATACTAACCCACCAATATTAATCTTCATAAGG
GGGACGGAGGAAATGAACAATAATTGGGGTGAACTTATTAACATCCACAACATGGATACTTAATTATTATTGGCAAATTTCTAAAGCAAAAAATA
GTGATTAATTTACCCCATAGTATAAGAAGGGGGTGGCAAATTGATCACAGGGGTCTTCACTTTAGTCATCATGTTAATACTGGTAGTAATCCCTT
GGGATCCAATTCCACTGTCCTTAATACCCGGGAACGGAAAATGATCCGGTCCACGAGCTGGAGCTGAGTTAATTTGAACGGTTCCGGTTTCCATT
GCATCACTGATCAGTATTGCTTTGTTGATGGCTTTGGGGAACACACAACCCTGCAGACCAAAATTGCTAGCATTGCAGGGGTGAATTCCTTCTTC
GACTGAGTTGATCCGAATAACGGGCAAAACTGGACCGAAGGGTTCTTCCCAAGCGATTCTCATGGCCGGCCTAACATTGTCTAACAACAAGGGCC
AGATAAGGGTGCCTTCTCTCTTGTATGGCTGGCAAAATGTTGCATCTTTCTCCTTTGCGGCCATGACCAGCCCCTCGATGAAATTTGCGGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E693660] SGN-U577789 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T494215 [Download] [View] Facility Assigned ID: LH_Ea01O10.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0090 Quality Trim Threshold: 20.5