EST details — SGN-E694193

Search information 
Request: 694193Match: SGN-E694193
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467359Clone name: LH_Ea03E15
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C467359 [LH_Ea03E15] Trace: SGN-T497522 EST: SGN-E690353 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E694193Length: 581 bp (1133 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E694193 [] (trimmed) TTTTTTTTTTTGTTTTTTTTTTTTTTTTTTTATGAGAAACCAATCTAGTAGTATTGAATGAAACAACGAATAATCAGTACCTAGCTTAGTTACAT
AAATAACAACAAACATTAAGCAACAATTGGTTCAGTAAGCAATTTTAATTTAAACAATAGAAATACATCAATCAGAAGTTAATTATAAGGGGGGA
TCAGAAAGATATGGATAGTTGAGAGTCGTGGGTATGAAGTTACATTTCAAGGAGTAGTGGTTTGGGGGGCATCAGCTGGAGTGGTGGGGAATGGG
GGAAATGGAAAACTAGGGAGCCCACCAAAGCCGCCGCCACCAGTTGATGGAGTAGGAAAACCTGGAGTAGTAGGCATAGGAAATGAGGGGAAACC
ACCACCAGTTGATGGAGTCGTAGGCATAGGAAATGAGGGGAAACCACCACCAGTTGATGGAGTAGTAGGCATAGGGAAACCACCAAATTGCTGAA
GACGTCGAGCTGCTGGGGCTTGCTCAATTGACATTACTGATACAACAAGCACGACAACGGCTATCATGACATTTATCTTCGCCATTTTTTGTTGT
TGGAAAAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E694193] SGN-U582571 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493297 [Download] [View] Facility Assigned ID: LH_Ea03E15.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5