EST details — SGN-E694343

Search information 
Request: 694343Match: SGN-E694343
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C467509Clone name: LH_Ea03K21
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C467509 [LH_Ea03K21] Trace: SGN-T496835 EST: SGN-E690503 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E694343Length: 777 bp (1103 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E694343 [] (trimmed) TTTTTTTTTTTTTTTTTTGAAAAAGTAGCACTACTACTACATAGATGAAACTCCACAGAAGATATATGACAAAATACATATTCAGCATAAAAAAA
CATATGCTTCCAGTTCCGTGGGATTCTGAAATACGAACTTACCCTAATTCCAAAATGGACCATACATTTTTATCTTAATTTCATCCTAAAACATC
TTAATTTACAGTCGATTTCTGAAAATTTTCAGTTAACGATTCAAGACGAAGTGATAAGCAGCTTCAAATCGAACTTACCGGTGCCGTTTTCTCCA
GAATTGACACAATCAAATCCACATCCACACTGTGGCGATTCATAGAAGTTATCAATTGCAAAATCAGCAGAAGCAATACCGACGGAGAAATCGAG
ATCGTCGCCGTCACGAGTAACTTCGACAATATTAATCCAAAACAAAAGCAGTTTCACCTGTACGCCTTTCAAGTTCGCAAGTCGATCCTTAGAGA
TTTTACCAGTAATCTTACTCATATACTTGAGATTATAGCCGCTTATGCTGAAACTGCACGATTTCCTCGTGCCGAATTCGGCACGAGGCCTCGTG
CCGAATCGGCACGAGGATTGAATCAGCAACTAAGTTTCTTTTGCAAAAGATCAAGGACTTGCAATTCTTTGTTGGGGAGAGCATGCATGATGATG
GTGCCCTGGTGTTTGCGTACTACAAGGATGGTGCAGCTGATCCTACCTTTTTGTACATTGCACCTGGTTTGAAGGAGATCAAGTGCTAGATGTCT
GGTGGAGTGCTTCTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E694343] SGN-U580515 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T493153 [Download] [View] Facility Assigned ID: LH_Ea03K21.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0024 Quality Trim Threshold: 20.5