EST details — SGN-E695342

Search information 
Request: 695342Match: SGN-E695342
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468508Clone name: LH_Ea06E12
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468508 [LH_Ea06E12] Trace: SGN-T496373 EST: SGN-E691502 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E695342Length: 287 bp (1062 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E695342 [] (trimmed) CAGGTTTCTGAATGAGGAAGGCCATGCACTGTGCCTGCTTAACATTATCAAACGCCAAGCAACCAATAAAAGCATTTGGGTAAGCTTTCTTGCAT
TCTTGGATTTCATTGAGAACCTGGGAAGAGTCATTGCAGCCAAACATGGGCAACTTCCACAGTGTCCAATATCTCCCATCATAGTAGCCTGGCAT
GTTGCTATTTTCCCTATGTACATATCCCACCTGGTCAAATTCAAGGCAAGGAACCCAACCCTTTTTGATTATGTAATCAACCTCCTTTGCTATGG
AC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E695342] SGN-U572962 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T492103 [Download] [View] Facility Assigned ID: LH_Ea06E12.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5