EST details — SGN-E695763

Search information 
Request: 695763Match: SGN-E695763
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468929Clone name: LH_Ea07G01
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468929 [LH_Ea07G01] Trace: SGN-T495513 EST: SGN-E691923 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E695763Length: 765 bp (1100 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E695763 [] (trimmed) TTTTTTTTTTTTTTAATGAAAAATAGTGGGATTACCTCTATATTCTCATCTCCTAGACTGATCTATCTAATACACCCTAACATCCCCAGCTTCTT
TTTTACATTGACAAGTAAAGTAGTAAAAGAATAGAATGAGCAATAAAGTAAAAGTTGAGTCAGTTGTTCCAAGAGCCTTTTCTGGTTTTCAGGAG
AGATGCATATAACAACTCGTTCCAAGTGTCGGGTACACCTGGTAGGCACCAATGACTGCAATCCTGAGAGTGTATTGCTTCTTCTACTCTCTTGT
ACTCCTTTCTGTATATCGATGGATGACCATCTTTACGATAGTCTGTAAGCCTACTAATGTTCGAGCATTGTCCGGGTTGCAGGCTAAGGAAGTGG
GACTTACAAAGGCGTCAAAAATTAAATATCTGATCATAATTGGAGGGGCTAAATTTCAGAATAAATCAGTGGCGGAAAAAGCTTATTCACCAGCA
ATTGCATGCCCTTCCGTTCATTTTTTAGGGGAGCAAGATTACCTAAAGAAGTATGGGATAGAACTGTTGGAATCATGTGTTGATCCAGTGGTGAT
TCATCATCCTAGGGGTCACACTATACCAAGATTTGATGAGAAAGGATTAGAGAGTATGCTTAGTTTCATTGAGAAGGTGCAAGAAGAGATTAACA
AGTGATCAAGTTTGATAATTTTTTTCAAAAAAAAAATAGTGCTAGTCCCTCGTTTGGGACATGTAGTTACCACCTTTTTTAAATATAAATAAAAT
AGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E695763] SGN-U564823 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T491680 [Download] [View] Facility Assigned ID: LH_Ea07G01.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0057 Quality Trim Threshold: 20.5