EST details — SGN-E695857

Search information 
Request: 695857Match: SGN-E695857
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469023Clone name: LH_Ea07J23
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U568655 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C469023 [LH_Ea07J23] Trace: SGN-T495411 EST: SGN-E692017 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E695857Length: 804 bp (1071 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E695857 [] (trimmed) TTTTTTTTTTTTTTTTTTAAAATGGTGGAATTTATTATACTTATTTAGATATAAGGGGAAATGCCAAAGGATTATAATTCCTTTTCTAAGAGAAG
CAAAGGGAAGAAGGCAACATTGTGACCTTACACTTATGTACTTCACCAACTTAATAAATCAAAAATGAAACAGGAATCTTGCTACGTATTTACTA
ACATTTACAAAAAGGTACTCCTGCAGAAAACTTGGAACAAGCTTCACAGCAACAGAAAGAACCCCGGAGAAATCTTGAACAATGCTTCCATGTCA
GCTGTGAAACTTGCTATTGTCAGTTTGAAGAGAGTGGTTTGACGGCACCATTATCAAGGATCAGAAGCACCAATTCTCGAGTTGTATAAACAAGT
CTATTAGTCACTCCGACTTATGACAAATCAAACGATCCTTGACCTTCATTAATGGCATAGAGTAATTTCTTGGACATGATCTCCTTAGTAGAATA
GGGAGGGAGTTTCAAGTAATTAGCACATGTCATCACACTGGGTAGGTCTTCATCTGCAGATTCTGATGGGGCATTACTGTTGTGTGCTGCATTGC
CAGCACTAGATGAATGCTTCCTCACAATTGTCAACTTAGGATTCAGAGAAGCAAGACCACCTGCGGGGAGCCGAGGAGCACCAGTGACAAACTGG
CAGAATGCTCGTTGCTGCTCAGGTGTGAACTCTCCCATAATCTCTAGTAAATGAATAATAGGAGGACTCTTGGATGTGAATCCATGATCGAATTT
TATGTGATCTACTAACGTCTCAGGCTTCCACAACTCTCTACGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E695857] SGN-U568655 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T491586 [Download] [View] Facility Assigned ID: LH_Ea07J23.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5