Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E696178

Search information 
Request: 696178Match: SGN-E696178
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469344Clone name: LH_Ea08H08
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469344 [LH_Ea08H08] Trace: SGN-T495145 EST: SGN-E692338 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E696178Length: 820 bp (1114 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E696178 [] (trimmed) TTTTTTTTAAAAAAAAACTGAACCACTTTTATTCATCTGGGTTTCTGAGTTAGTGTAACAATATTATTACTCAGACCAGTACATGAAAATTAAAA
CACAAGCATATACTCACTAGGAGCATGCATATTTATTCTACTAGTTCCAAATATAATCATATTTAAAGTCCACAATAAGTCTTCAAAGCAGATTC
ACATCTCATGCCTTCTTCAGTGTTGGTGAAAGCAAGAAATTCATGAAGATCAAAGGGCTTATATAGTAGAGGATGCTCTTCATCTACCATCTCTT
TTGGTGCCTTTATTGTGTAGTCACCTTTAGGTACTGAAAACAAACCAACTGAGTATCTTGCTTTGTTTCCCCTCATCATCACTCTATGATATGGT
GCATGCATTCGACCATTTGTCCATGCATGTAGAGAGTCTCCAATCATGACAGTGAAAGTGTCTTGTGTGGGTTCAACATTGATCCACTGCCCATT
TTTGTTCATAACTTGAAGACCGTTTATCTGATTTTGGTAGAGTATAGTAGCAATGCTCTTGTCTGTATGAGCACTTACTCCTATTTCAGTCTCAG
TATTACTTTGAGGTGTGTTATACTTCATCAATCGAAGAACGAAATTGGTTGAATTCATATGCTCATCCATGTACTTTTCTAGACCTAAGCTCTCC
AAAACCATTCTCCTTACTGTCTGATCTAACTCTGATAGTTGCTCAGAGTATGACTGAATAGTTTTACAGAAAGAAGGATTTCCTTGGGGCCATAA
AATTTGAGCGAATTCATCAGCTTTACGGGGGATGTTAGCATCATCAATGCCCATACTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E696178] SGN-U575220 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T491697 [Download] [View] Facility Assigned ID: LH_Ea08H08.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0037 Quality Trim Threshold: 20.5