EST details — SGN-E696378

Search information 
Request: 696378Match: SGN-E696378
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C469544Clone name: LH_Ea08P16
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C469544 [LH_Ea08P16] Trace: SGN-T494953 EST: SGN-E692538 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E696378Length: 472 bp (1091 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E696378 [] (trimmed) TTTTTTTTTTTTTACTAGAAAACATTCTCATGGGCCCCTCCCTTACCACTAAACATCAGTCAACAGTTTTGATAGTAGATTCACAAGTTAATATA
CATATATATTTATTTAATTTTTTAATATAAATACATGATCTACGAAAAATTATGAATTCATAGACTCCACTTTATTAAGTTTTTGCTACTTCCAT
GCCAATTGAAATAGTGCTTCATGTCCAATTTGATCCCATATATAGTCCTATAGTGAAATCGGGACAAGTCGTAGAGGACGTAATTTGCCTACAAT
AAGACCACTTTTCTCCTCCGCGTCCAAATCATCGTTGCCTTCAACAACCCAATCAAATGAATTCAACAACGAACCCAACATTATGGGAACCGTCC
TCATAGCCAAAGATATTGCAGGACACATTCTTCGACCAACACCAAAAGGAATAAGCTTAAAATCATCTTGACCACGAATATCCATAACATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E696378] SGN-U566284 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T491039 [Download] [View] Facility Assigned ID: LH_Ea08P16.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5